generalized linear model fit program jmp v. 12.0.1 Search Results


modeling  (STATA Corporation)
99
STATA Corporation modeling
Modeling, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/generalized+linear+model+fit+program+jmp+v%2E+12%2E0%2E1/STATA+12%2E0/pm25486289-53-3-4
Average 99 stars, based on 1 article reviews
modeling - by Bioz Stars, 2026-10
99/100 stars
  Buy from Supplier
oxygen microelectrode-potentiometric recording assembly microsensor model 1201  (Transidyne General Corp)
90
Transidyne General Corp oxygen microelectrode-potentiometric recording assembly microsensor model 1201
Oxygen Microelectrode Potentiometric Recording Assembly Microsensor Model 1201, supplied by Transidyne General Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/generalized+linear+model+fit+program+jmp+v%2E+12%2E0%2E1/chemical+microsensor/pm00573633-44-10-17
Average 90 stars, based on 1 article reviews
oxygen microelectrode-potentiometric recording assembly microsensor model 1201 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
strep tactin resin  (IBA Lifesciences)
96
IBA Lifesciences strep tactin resin
Strep Tactin Resin, supplied by IBA Lifesciences, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/generalized+linear+model+fit+program+jmp+v%2E+12%2E0%2E1/Strep-Tactin+Sepharose+resin/pmc06263799-274-114-116
Average 96 stars, based on 1 article reviews
strep tactin resin - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier
zl-1201 anti-cd47 humanized igg4 monoclonal antibody  (ZAI Lab)
90
ZAI Lab zl-1201 anti-cd47 humanized igg4 monoclonal antibody
Zl 1201 Anti Cd47 Humanized Igg4 Monoclonal Antibody, supplied by ZAI Lab, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/generalized+linear+model+fit+program+jmp+v%2E+12%2E0%2E1/zl+1201/pmc09028741-105-0-1
Average 90 stars, based on 1 article reviews
zl-1201 anti-cd47 humanized igg4 monoclonal antibody - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
gurobi 12 0 1  (Gurobi Optimization)
86
Gurobi Optimization gurobi 12 0 1
Gurobi 12 0 1, supplied by Gurobi Optimization, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/generalized+linear+model+fit+program+jmp+v%2E+12%2E0%2E1/0+0+12+gurobi/pmc12894843-114-9-9
Average 86 stars, based on 1 article reviews
gurobi 12 0 1 - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier
macvector 12.0.1  (MacVector inc)
90
MacVector inc macvector 12.0.1
Macvector 12.0.1, supplied by MacVector inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/generalized+linear+model+fit+program+jmp+v%2E+12%2E0%2E1/macvector+7+0+software/10__1074_slash_jbc__ra117__001042-244-26-26
Average 90 stars, based on 1 article reviews
macvector 12.0.1 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
n-12:0-1-deoxysphinganine  (Avanti Polar)
90
Avanti Polar n-12:0-1-deoxysphinganine
N 12:0 1 Deoxysphinganine, supplied by Avanti Polar, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/generalized+linear+model+fit+program+jmp+v%2E+12%2E0%2E1/N-12%3A0-1-deoxysphinganine/custom%40860481p%4032549981
Average 90 stars, based on 1 article reviews
n-12:0-1-deoxysphinganine - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
ttgccggtctggcggcggcgc  (Addgene inc)
91
Addgene inc ttgccggtctggcggcggcgc
Ttgccggtctggcggcggcgc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/generalized+linear+model+fit+program+jmp+v%2E+12%2E0%2E1/pSup35C+(Plasmid+%231201)/pmc07760495-275-13-23
Average 91 stars, based on 1 article reviews
ttgccggtctggcggcggcgc - by Bioz Stars, 2026-10
91/100 stars
  Buy from Supplier
homology search genetyx version 12.0.1  (GENETYX CORPORATION)
90
GENETYX CORPORATION homology search genetyx version 12.0.1
Homology Search Genetyx Version 12.0.1, supplied by GENETYX CORPORATION, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/generalized+linear+model+fit+program+jmp+v%2E+12%2E0%2E1/search+homology+of+sequence+analysis+soft+genetyx+mac+10+1/us11932880-99-32-31
Average 90 stars, based on 1 article reviews
homology search genetyx version 12.0.1 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
pericyte (basal) medium sciencell 1201  (ScienCell)
90
ScienCell pericyte (basal) medium sciencell 1201
Pericyte (Basal) Medium Sciencell 1201, supplied by ScienCell, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/generalized+linear+model+fit+program+jmp+v%2E+12%2E0%2E1/pericyte+medium+sciencell+1201/pmc11286182-13-4-4
Average 90 stars, based on 1 article reviews
pericyte (basal) medium sciencell 1201 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
ansys vers.12.0.1  (ANSYS inc)
90
ANSYS inc ansys vers.12.0.1
Ansys Vers.12.0.1, supplied by ANSYS inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/generalized+linear+model+fit+program+jmp+v%2E+12%2E0%2E1/ansys+vers+12+0+1/pm21269846-39-63-64
Average 90 stars, based on 1 article reviews
ansys vers.12.0.1 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
3d finite volume method ansys 12.0.1  (ANSYS inc)
90
ANSYS inc 3d finite volume method ansys 12.0.1
3d Finite Volume Method Ansys 12.0.1, supplied by ANSYS inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/generalized+linear+model+fit+program+jmp+v%2E+12%2E0%2E1/3d+finite+volume+method+ansys+12+0+1/10__1016_slash_j__csite__2017__03__005-37-10-10
Average 90 stars, based on 1 article reviews
3d finite volume method ansys 12.0.1 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

Image Search Results